# About: Convert between textual and numeric flag representation In SAMtools version 1.3 or newer, you can directly generate a Slightly more compact than unsorted BAM files, you should always sortedīAM files. Many downstream tools require sorted BAM files and since they are You can generate this information againīy running the command below, where ref.fa is the reference FASTA file If you don’t see lines starting with the symbol, the header Reference sequence name and LN refers to the reference sequence length. The tag is the reference sequence dictionary SN refers to the The lines starting with an symbol contains the header information. # ERR188273.4711308 133 chrX 21649 0 * = 21649 0 CTACAGGTGCCCGCCACCATGCCCAGCTAATTTTTTTTGTATTTTTAGTAGAGATGGGGTTTCACTGTGTTGGCC YT:Z:UP # ID:samtools PN:samtools PP:hisat2 VN:1.14 CL:samtools view -h eg/ERR188273_chrX.bam # help display this help message or help for # samples list the samples in a set of SAM/BAM/CRAM files # depad convert padded BAM to unpadded BAM
# ampliconstats generate amplicon specific stats # coverage alignment depth and percent coverage # import Converts FASTA or FASTQ files to SAM/BAM/CRAM # quickcheck quickly check if SAM/BAM/CRAM file appears intact # collate shuffle and group alignments by name # ampliconclip clip oligos from the end of reads # targetcut cut fosmid regions (for fosmid pool only) # calmd recalculate MD/NM tags and '=' bases # Program: samtools (Tools for alignments in the SAM format) Script if you want to generate this file yourself, please use thisĪnd the Makefile in this directory. This README is generated using the create_readme.sh (stored in the eg folder) generated as per The examples in this README use the ERR188273_chrX.bam BAM file Latest information on SAMtools, please refer to the release High-throughput sequencing data, at some point you will probably have toĭeal with SAM/BAM files, so familiarise yourself with them! For the The SAM (Sequence Alignment/Map) format (BAM is just theīinary form of SAM) is currently the de facto standard for storing SAMtools provides various (sub)tools for manipulating alignments in the
Wed 04:45:03 AM UTC Learning the BAM format Introduction Extracting only the first read from paired end BAM files.Extracting entries mapping to a specific loci.
0 kommentar(er)
